View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10161_low_12 (Length: 377)
Name: NF10161_low_12
Description: NF10161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10161_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 192 - 365
Target Start/End: Complemental strand, 48284646 - 48284473
Alignment:
| Q |
192 |
agtgaactctgaattcattgtgttctgttattttccttttgaactttgtgtctcgttattccaacccattttggggattgttgactgacttgattttggt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
48284646 |
agtgaactctgaattcattgtgttctgttattttccttttgaactttgtgtctcgttattccaacccgttttgcgaattgttgactgacttgattttggt |
48284547 |
T |
|
| Q |
292 |
ttaggatttggatccttcaccaattgtctacaattaattttaacagggttttcacagttgagctctcacaggtt |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
48284546 |
ttaggatttggatccttcaccaattgtctacaattaattttaacagggttttcatagttgagctctcgcaggtt |
48284473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 60 - 170
Target Start/End: Complemental strand, 48284750 - 48284643
Alignment:
| Q |
60 |
agtatggaatccgctcccagttgccagaatgatagggttgccaagaaaattaaaattgaattttctgctagagctctaggtggttgaacacgaagaggga |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48284750 |
agtatggaatccgctcccagttgccagaatgatagggttgccaagaaaattaaaattgaattttctgctagagctcta---ggttgaacacgaagaggga |
48284654 |
T |
|
| Q |
160 |
agggggtagtg |
170 |
Q |
| |
|
||||||||||| |
|
|
| T |
48284653 |
agggggtagtg |
48284643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 48284809 - 48284772
Alignment:
| Q |
26 |
ttcaaacatacacaaacttacaattatatgggtgagta |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48284809 |
ttcaaacatacacaaacttacaattatatgggtgagta |
48284772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University