View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10161_low_17 (Length: 333)
Name: NF10161_low_17
Description: NF10161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10161_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 43 - 173
Target Start/End: Original strand, 35702637 - 35702767
Alignment:
Q |
43 |
aacgccgtcgtatcagcattatgaaccctaatcaaattacttgtagattatgctttattgtaatttgaattttgtggatttaattatgggtttgatcttg |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
T |
35702637 |
aacgccgtcgtatcagcattatgaaccctaatcaaattacttgtagattatgctttattgtaatttgagttttgtggatttcattatgggtttgatcttg |
35702736 |
T |
 |
Q |
143 |
aacaactcatgaaagataaagtcccaaaatt |
173 |
Q |
|
|
|||||||||||||||||||||| |||||||| |
|
|
T |
35702737 |
aacaactcatgaaagataaagttccaaaatt |
35702767 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 243 - 316
Target Start/End: Original strand, 35702824 - 35702897
Alignment:
Q |
243 |
gtcttagcagtaataatctgttttgaggttattacactannnnnnnatgttattttttatgttaacagtctgtg |
316 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||| |
|
|
T |
35702824 |
gtcttagcagtaataatctgttttgaggttattacgctatttttttatgttatttttcatgttaacagtctgtg |
35702897 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University