View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10161_low_29 (Length: 259)
Name: NF10161_low_29
Description: NF10161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10161_low_29 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 108 - 259
Target Start/End: Complemental strand, 14250016 - 14249865
Alignment:
| Q |
108 |
ggctctatgggtgaagcttccgcggcgaggttagggaattatcttcctggtcatctgaatttgttggcttcattgtctggtgggaatggaaattctggtc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14250016 |
ggctctatgggtgaagcttccgcggcgaggttagggaattatcttcctggtcatctgaatttgttggcttcattgtctggtgggaatggaaattctggtc |
14249917 |
T |
|
| Q |
208 |
gtggagatgatgaagatcgttgaaccggggaattccgtgttttctactttat |
259 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |||||||| |
|
|
| T |
14249916 |
gtggagatgatgaagatcgttgaaacggggaattcggtgttttgtactttat |
14249865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 112 - 230
Target Start/End: Original strand, 51615349 - 51615467
Alignment:
| Q |
112 |
ctatgggtgaagcttccgcggcgaggttagggaattatcttcctggtcatctgaatttgttggcttcattgtctggtgggaatggaaattctggtcgtgg |
211 |
Q |
| |
|
|||||||||||||||| || || || | ||||||||||||||||||||||| |||||| | ||||| ||||||||||| |||||||||||||||| | |
|
|
| T |
51615349 |
ctatgggtgaagcttcagctgctagagttgggaattatcttcctggtcatctcaatttgcttgcttcgttgtctggtggacatggaaattctggtcggag |
51615448 |
T |
|
| Q |
212 |
agatgatgaagatcgttga |
230 |
Q |
| |
|
|||||||||| ||| |||| |
|
|
| T |
51615449 |
agatgatgaacatcattga |
51615467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University