View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10161_low_34 (Length: 248)
Name: NF10161_low_34
Description: NF10161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10161_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 34564019 - 34563839
Alignment:
| Q |
19 |
gtaaagtggatatgacacatcaacttgagattatcattggttgatccttctttgtttgcaatttgcagccgttttactcgtcaggctggcattggcaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34564019 |
gtaaagtggatatgacacatcaacttgagattatcattggttgatccttctttgtttgcaatttgcagccgttttactcgtcaggctggcattggcaaac |
34563920 |
T |
|
| Q |
119 |
gaattgaacatatgatgatttcagctaaattcagatcagatacactcaaccgcacttcaatttagtgattcatacgtacac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34563919 |
gaattgaacatatgatgatttcagctaaattcagatcagatacactcaaccgcacttcaatttagtgattcatacgtacac |
34563839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University