View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10161_low_37 (Length: 241)
Name: NF10161_low_37
Description: NF10161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10161_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 182 - 225
Target Start/End: Complemental strand, 13649435 - 13649392
Alignment:
| Q |
182 |
tcgaccaggaatcttggcttatcccctttgtgttaccaaatctt |
225 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13649435 |
tcgaccgggaatcttggcttatcccctttgtgttaccaaatctt |
13649392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University