View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10161_low_38 (Length: 240)
Name: NF10161_low_38
Description: NF10161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10161_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 8183937 - 8183715
Alignment:
| Q |
1 |
tagtgatgcgaaaataaatcaagaacatgccaaaggatgtagacaggaagcgcaagtggttggtgcagaatgtgtgtgagtattgtaaactcttaagtac |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8183937 |
tagtgatgcaaaaataaatcaagaacatgccaaaggatgtagataggaagcgcaagtggttggtgcggaatgtgtgtgagtattgtaaactcttaagtac |
8183838 |
T |
|
| Q |
101 |
cgagttcaatttctacaaataagaaaataaggttggtttgggttcctcagggaaaattgaagtttatttttctgcaaaccaacattagcttaagataatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8183837 |
cgagttcaatttctacaaataagaaaataaggttggtttgggttcctcagggaaaattgaagtttacttttctgcaaaccaacattagcttaagataatt |
8183738 |
T |
|
| Q |
201 |
taatgcatagtgtgattctaaaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8183737 |
taatgcatagtgtgattctaaaa |
8183715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 93
Target Start/End: Complemental strand, 6833200 - 6833156
Alignment:
| Q |
49 |
agcgcaagtggttggtgcagaatgtgtgtgagtattgtaaactct |
93 |
Q |
| |
|
||||||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
6833200 |
agcgcaagtagttggtgtagagtgtgtgtgagtattgtaaactct |
6833156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University