View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10161_low_41 (Length: 237)
Name: NF10161_low_41
Description: NF10161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10161_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 224
Target Start/End: Original strand, 45067279 - 45067489
Alignment:
| Q |
15 |
aaagggggaaaaagattccatgttgtagtgaaatttaactgtttgatcaaaattagacaactcatatatcaaattcatattttaaatttaatttacatag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45067279 |
aaagggggaaaaagattccatgttgtagtgaaatttaactgtttgatcaaaattagacaactcatatatcaaattcatattttaaatttaatttacatag |
45067378 |
T |
|
| Q |
115 |
tcggaacaggagccgtcaaatcttcatctaatagttcaaattgcttgatatcggct-acacatgatctcctaactgaaggagatccatatccagggggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45067379 |
tcggaacaggagccgtcaaatcttcatctaatagttcaaattgcttgatatcggctaacacatgatcttctaactgaaggagatccatatccagggggag |
45067478 |
T |
|
| Q |
214 |
cgaggggtgat |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
45067479 |
cgaggggtgat |
45067489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University