View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10162_high_14 (Length: 289)
Name: NF10162_high_14
Description: NF10162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10162_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-147; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 6 - 276
Target Start/End: Original strand, 43378938 - 43379208
Alignment:
| Q |
6 |
agacaacggagcagatatcaagtgtcgcgtggcggccactgattgcattgatctcaaacaagttggtactcttacccgcgttcgtggtttggccataagc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43378938 |
agacaacggagcagatatcaagtgtcgcgtggcggccactgattgcattgatctcaaacaagttggtactcttacccgcgttcgtggtttggccataagc |
43379037 |
T |
 |
| Q |
106 |
cacttccttatcgttggaatcaaatgcataggcgcgtacaaagtacgttgcttgaggcacgtcgcgctgaatcaaccactcgaaggtttggaccgttttg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43379038 |
cacttccttatcgttggaatcaaatgcataggcgcgtacaaagtacgttgcctgaggaacgtcgcgctgaatcaaccactcgaaggtttggaccgttttg |
43379137 |
T |
 |
| Q |
206 |
ttggaagcattgtatggcatggctaacattttgtgttggcaagttttgtccctagagagttcatcctctgt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43379138 |
ttggaagcattgtatggcatggctaacattttgtgttggcaagttttgtccctagagagttcatcctctgt |
43379208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 6 - 273
Target Start/End: Original strand, 43384021 - 43384288
Alignment:
| Q |
6 |
agacaacggagcagatatcaagtgtcgcgtggcggccactgattgcattgatctcaaacaagttggtactcttacccgcgttcgtggtttggccataagc |
105 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43384021 |
agacaacggagcagatatcaagagtcgcgtggcggccactgattgcgttgatctcaaacaagttggtactcttacccgcgttcgtggtttggccataagc |
43384120 |
T |
 |
| Q |
106 |
cacttccttatcgttggaatcaaatgcataggcgcgtacaaagtacgttgcttgaggcacgtcgcgctgaatcaaccactcgaaggtttggaccgttttg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43384121 |
cacttccttatcgttggaatcaaatgcataggcgcgtacaaagtacgttgcctgaggaacgtcgcgctgaatcaaccactcgaaggtttggaccgttttg |
43384220 |
T |
 |
| Q |
206 |
ttggaagcattgtatggcatggctaacattttgtgttggcaagttttgtccctagagagttcatcctc |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43384221 |
ttggaagcattgtatggcatggctaacattttgtgttggcaagttttgtccctagagagttcatcctc |
43384288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University