View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10162_low_27 (Length: 242)
Name: NF10162_low_27
Description: NF10162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10162_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 5 - 162
Target Start/End: Complemental strand, 10479170 - 10479013
Alignment:
| Q |
5 |
ttatttcatttgtataaggttcttcatttaaatttgaattctggtttatgtttactattttatttctgtaaattcgatgttgagagggaaatgaagtagt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10479170 |
ttatttcatttgtataaggttcttcatttaaatttgaattctggtttatggttactattttatttctgtaaattcgatgttgagagggaaatgaagtagt |
10479071 |
T |
|
| Q |
105 |
tttttgtttggaacctgtaataattctgttcttttagtatgtttacggaaaaccatac |
162 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
10479070 |
tttttgtttggaacctgtaataactctgttcttttagtatgtttacggaaagccatac |
10479013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University