View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_high_24 (Length: 319)
Name: NF10163A_high_24
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_high_24 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 16 - 319
Target Start/End: Complemental strand, 5395566 - 5395263
Alignment:
| Q |
16 |
atgtagaagtacaacgaacctcacttagagaatttctccaactcgacaccactctccgccaaaatgcacaacttaaagaagctatgaattcaacctactc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395566 |
atgtagaagtacaacgaacctcacttagagaatttctccaactcgacaccactctccgccaaaatgcacaacttaaagaagctatgaattcaacctactc |
5395467 |
T |
 |
| Q |
116 |
acgtattcaaagccttgagaaagagcttagttgcatgaagaagtttcttcaggatcatcaagctgaggatgaaaaggagaaggagaaagaaaaagagaag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395466 |
gcgtattcaaagccttgagaaagagcttagttgcatgaagaagtttcttcaggatcatcaagctgaggatgaaaaggagaaggagaaagaaaaagagaag |
5395367 |
T |
 |
| Q |
216 |
gaacaaagcaatagtgtcttgaattcagaacgttccgcaagttttcattttgttccggttgatgaaaacagtaaaatacaaagaggtggaagaggctcta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395366 |
gaacaaagcaatagtgtcttgaattcagaacgttccgcgagttttcattttgttccagttgatgaaaacagtaaaatacaaagaggtggaagaggctcta |
5395267 |
T |
 |
| Q |
316 |
tttc |
319 |
Q |
| |
|
|||| |
|
|
| T |
5395266 |
tttc |
5395263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University