View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_high_26 (Length: 310)
Name: NF10163A_high_26
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10163A_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 58 - 194
Target Start/End: Original strand, 15827214 - 15827348
Alignment:
Q |
58 |
tttaggtgatctatgattgcatttgagataagactatacctttttacttgacacttgatatgcctcaatacttctgctgatagacaagctagactattgt |
157 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
15827214 |
tttaggtgatctatgattgcatt-gagataagactatacctttttacttgacacctgatatgcctcaatacttctgctgatagacaagctagactcttgt |
15827312 |
T |
 |
Q |
158 |
gatttcttcatgaaattgttaaagcatatgagtcaag |
194 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||| |
|
|
T |
15827313 |
gatttcttcatgaaattgtt-aagcatatgagtcaag |
15827348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 187 - 291
Target Start/End: Original strand, 15827495 - 15827599
Alignment:
Q |
187 |
gagtcaagtgtatggtttctctcataaaaaatttcattttgaacattgggatatgactcgcaagtggaatttcttatgatataaccaacattttgtattt |
286 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
15827495 |
gagtcaagtgtatggtttctctcataaaaaatttcattttgaacattgggatatgactcgcaagtggaatttctcatgatataaccaacattttgtattt |
15827594 |
T |
 |
Q |
287 |
tgatg |
291 |
Q |
|
|
||||| |
|
|
T |
15827595 |
tgatg |
15827599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 106
Target Start/End: Complemental strand, 5600674 - 5600618
Alignment:
Q |
49 |
tcttctctttttaggtgatctatgattgcatttgagataagactatacctttttactt |
106 |
Q |
|
|
||||||||||||||||||||||||||| || ||||||| ||||| || ||||||||| |
|
|
T |
5600674 |
tcttctctttttaggtgatctatgattaca-ttgagatgagactctatgtttttactt |
5600618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University