View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_high_32 (Length: 237)
Name: NF10163A_high_32
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_high_32 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 42447430 - 42447666
Alignment:
| Q |
1 |
atatggtattgataaagtgacttacaaacatttcggaaaacacatggaatacaaacttggaacaaactaaaaataatgacaaaacatatcggaagaaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42447430 |
atatggtattgataaagtgacttacaaacatttcggaaaacacatggaatacaaacttggaacaaactaaaaataatgacaaaacatttcggaagaaata |
42447529 |
T |
 |
| Q |
101 |
taacatgtaaatcatcaaaacaccagaagttccacaagaattagatgcccatacgagcactaatctcttgttaatcccagtggctcccagcgagcgaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
42447530 |
taacatgtaaatcatcaaaacaccagaagttccacaagaattagatgcccatacgagcactattctctcgttaatcccagtagctcccagcgagcgaaag |
42447629 |
T |
 |
| Q |
201 |
tcctttctgaactagcaagtttttcacatgcacaaca |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42447630 |
tcctttctgaactagcaagtttttcacatgcacaaca |
42447666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University