View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_high_42 (Length: 217)
Name: NF10163A_high_42
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10163A_high_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 6111149 - 6111322
Alignment:
Q |
18 |
gacatcagatgatagggaggaaaggaaaaccatacctgaagtgactcagcatcagtagtcatcaagttggttatttttccagatgcaaattgttttcgcg |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6111149 |
gacatcagatgatagggaggaaaggaaaaccatacctgaagtgactcagcatcagtagtcatcaagttggttatttttccagatgcaaattgttttcgcg |
6111248 |
T |
 |
Q |
118 |
cttcgtgagtaagccttagagacttgcgaaatactgctgctacctacaaggaaggaaaatggaacaccaaactc |
191 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6111249 |
cttcgtgagtaagccttagagacttgcgaaatactgctgctacctacaaggaaggaaaatggaacaccaaactc |
6111322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University