View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_high_8 (Length: 438)
Name: NF10163A_high_8
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 21 - 419
Target Start/End: Complemental strand, 14858604 - 14858206
Alignment:
| Q |
21 |
atatattcacaaagtccactcaattgtgtcgaaggctttactaattgcaattttgagggccatgtttccaccataaactttcctatccaatagattgacg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14858604 |
atatattcacaaagtccactcaattgtgtcgaaggctttactaattgcaattttgagggccatgtttccaccataaactttcctatccaatagattcacg |
14858505 |
T |
 |
| Q |
121 |
gctttagaggctatcattatgcaatcttgtgcttgcggcctggtaaaaatcctctttgctgatgagagactatcctggaagcaataccccctaacctatc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14858504 |
gctttagaggctatcattatgcaatcttgtgcttacggcctggtaaaaatcctctttgctgaggagagactatcctggaagcaataccccctaacctatc |
14858405 |
T |
 |
| Q |
221 |
agccaagatcttagttatgatcttgaattggaagtttgccagcgcaatgggcctgaaattatcaagatgatccgctccatgaactttgggaaccagcaca |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14858404 |
agccaagatcttagttatgatcttgaattggaagtttgctagcgcaatgggcctgaaattatcaagatgatccgctccatgaactttgggaaccagcaca |
14858305 |
T |
 |
| Q |
321 |
atcagattggagttcagattcggaagaatgtgattgttggtgnnnnnnnttgagtggacttgacgacatcagacccaataatagatcagaaatgatgat |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14858304 |
atcagattggagttcagattcggaagaatgtgattgttggtgaaataaattgagtggacttgacgacatcagacccaataatagatcagaaatgatgat |
14858206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 213 - 286
Target Start/End: Original strand, 52781206 - 52781279
Alignment:
| Q |
213 |
aacctatcagccaagatcttagttatgatcttgaattggaagtttgccagcgcaatgggcctgaaattatcaag |
286 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||| |||| ||||| || |||||||| ||||| |
|
|
| T |
52781206 |
aacctatcagccaagatcttagtgataatcttgaattggaagttagccaaggcaattggtctgaaattgtcaag |
52781279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University