View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_100 (Length: 275)
Name: NF10163A_low_100
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10163A_low_100 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 22 - 264
Target Start/End: Complemental strand, 29669076 - 29668834
Alignment:
Q |
22 |
ctcaagaacagtggttaactccttgattattttctcctcaacttttggatggttcatgaccagccagaagaaccagctgagagcaactgatgacgtgtcc |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29669076 |
ctcaagaacagtggttaactccttgattattttctcctcaactttcggatggttcatgaccagccagaagaaccagctgagagcaactgatgacgtgtcc |
29668977 |
T |
 |
Q |
122 |
cttccagcaaggatgaagtttaagatgatgtgttgtagaatcgtggcgttgattggctttccgtctatgtctcgtttcttcatgaaacgtgacattaagt |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29668976 |
cttccagcaaggatgaagtttaagatgatgtgttgtagaatcgtggcgttgattggctttccgtctatgtctcgtttcttcatgaaacgtgacattaagt |
29668877 |
T |
 |
Q |
222 |
cgtcagaaggggtttccttacgatctgaaatggcgttgttcat |
264 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29668876 |
catcagaaggggtttccttacgatctgaaatggcgttgttcat |
29668834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 80 - 141
Target Start/End: Complemental strand, 11315194 - 11315133
Alignment:
Q |
80 |
accagccagaagaaccagctgagagcaactgatgacgtgtcccttccagcaaggatgaagtt |
141 |
Q |
|
|
|||| ||| ||||||||||| | ||||||||||||||||| | |||||| ||||||||||| |
|
|
T |
11315194 |
accaaccaaaagaaccagctcaacgcaactgatgacgtgtcacgtccagctaggatgaagtt |
11315133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University