View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_101 (Length: 275)
Name: NF10163A_low_101
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_101 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 42 - 270
Target Start/End: Complemental strand, 7951702 - 7951473
Alignment:
| Q |
42 |
tgattaatcctaagtgcttaattagtgagacaacaaatcttagaaaatggtggaaaagggcaataaaggaacggtggattcaacaaatactaggcattgt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7951702 |
tgattaatcctaagtgcttaattagtgagacaacaaatcttagaaaatggtggaaaagggcaataaaggaacggtggattcaacaaatgctaggcattgt |
7951603 |
T |
 |
| Q |
142 |
tcaaccgtactttgtattgtttgttaactttgttatgaatgaaatgtattaagtttggttttttagaaaataaaaaatgtattcacaagagagctatact |
241 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7951602 |
tcaaccgtactttgtattgtttattagccttgttatgaatgaaatgtattaagtttggttttgcagaaaataaaaaatgtattcacaagagagctatact |
7951503 |
T |
 |
| Q |
242 |
ctttcttatcc-ttttcttggtcaaatctt |
270 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |
|
|
| T |
7951502 |
ctttcttatccttttttttggtcaaatctt |
7951473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University