View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_106 (Length: 268)
Name: NF10163A_low_106
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_106 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 23722262 - 23722513
Alignment:
| Q |
1 |
tcatatagcaggcctctcgactacttgctaacattgttaaacacatgtttcaaattgagatttaacatttcgagaagttggagaccaaatgaccctattc |
100 |
Q |
| |
|
|||||||| ||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||| |||| |||| |
|
|
| T |
23722262 |
tcatataggaggtctctcaactacttgctaacattgttaaacacatggttcaaattgagatttaacatttcgggaagttggaggccaaattaccccattc |
23722361 |
T |
|
| Q |
101 |
cggtgatgaatttgtcacctctattattcatggaatataaaggaaccaatgtcaggcaggtgttgcgatccaaattcagttgattgtggcaatgttaggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23722362 |
tggtgatgaatttgtcacctctattattcatggaatataaaggaa-caatgtcaggcaggtgttgcgatccaaattcagttgattgtgggaatgttaggt |
23722460 |
T |
|
| Q |
201 |
tcaatcgagtcatatacaataggcaccaaccctcttgaggttggtctaatgat |
253 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23722461 |
tcaatcaagtcatatacaataggcaccaaccctcttgaagttggtctaatgat |
23722513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University