View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_111 (Length: 265)
Name: NF10163A_low_111
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_111 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 13879884 - 13879697
Alignment:
| Q |
1 |
agaaaatctcactctgtcaactgtcaacacaatggcatttacccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcattcgc |
100 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879884 |
agaaaatctcact--gtcaactgttaacacaatggcattttcccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcattcgc |
13879787 |
T |
 |
| Q |
101 |
caccgccccttcgctactgccgccatgtctctggttgccatctcctacgctgctcctcgactcattcactatttcaacaccaatgagctg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
13879786 |
caccgccccttcgctactgccgccatgtctctggttgccatctcctacgccactccacgactcattcgctatttcaacaccaatgagctg |
13879697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 24 - 187
Target Start/End: Complemental strand, 13875640 - 13875477
Alignment:
| Q |
24 |
tcaacacaatggcatttacccgcctcctttcttcctcttaccactctttcatgtccgccgtgcctgcattcattcgccaccgccccttcgctactgccgc |
123 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||| |||| ||| |||||| ||||||||||| || ||||||||| || |||| ||||||||||||| |
|
|
| T |
13875640 |
tcaacacaatggcattttcccgcctcctctcttcctgctaccgctcattcatggccgccgtgccttcactcattcgccgccaccccgtcgctactgccgc |
13875541 |
T |
 |
| Q |
124 |
catgtctctggttgccatctcctacgctgctcctcgactcattcactatttcaacaccaatgag |
187 |
Q |
| |
|
|||||| || || |||||||||||| | || |||| |||||||| ||||||||||||||||||| |
|
|
| T |
13875540 |
catgtcactcgtagccatctcctacaccgcacctccactcattcgctatttcaacaccaatgag |
13875477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 215 - 260
Target Start/End: Complemental strand, 13879675 - 13879630
Alignment:
| Q |
215 |
gatgatgatgatcttgttctctgggattttacggagactgaggagt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879675 |
gatgatgatgatcttgttctctgggattttacggagactgaggagt |
13879630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University