View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_112 (Length: 264)
Name: NF10163A_low_112
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_112 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 140 - 241
Target Start/End: Complemental strand, 41660154 - 41660054
Alignment:
| Q |
140 |
gaagaatataacataacataaacgactcatttgggggaaactaaaacccaaaacatcaatccggaaataatgttaaactgaaataatagcaggcatggtt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41660154 |
gaagaatataacataacataaacgtctcatttgggggaaactaaa-cccaaaacatcaatccggaaataatgttaaactgaaataatagcaggcatggtt |
41660056 |
T |
|
| Q |
240 |
tt |
241 |
Q |
| |
|
|| |
|
|
| T |
41660055 |
tt |
41660054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University