View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_114 (Length: 260)
Name: NF10163A_low_114
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_114 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 254
Target Start/End: Complemental strand, 11565736 - 11565490
Alignment:
| Q |
8 |
gagtgaaacgaacggatagagattagatcgagggtgggaaatggtgcatagacatgaacgacggaaatggcgcagattgtggtgagttatggggaacaga |
107 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11565736 |
gagtgaaatgaacggatagatattagatcgagggtgggaaatggtgcatagacatgaacgacggaaatggcgcagattgtggtgagtaatggggaacaga |
11565637 |
T |
|
| Q |
108 |
ggattaactgcgttgtggtagttcgggttcgtcgaagaagttgtgtttcacgtgaatggatagataataggtattgataactgattgagtaaagaagaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11565636 |
ggattaactgcgttgtggtagttcgggttcgtcgaagaagttgtgtttcacgtgaatggatagataataggtattgataactgattgagtaaagaagaaa |
11565537 |
T |
|
| Q |
208 |
caagtgtttaattccaacaatttgtagtgcacttgcatattattcga |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
11565536 |
caagtgtttaattccaacaatttgtagtgcacttgcatttcattcga |
11565490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University