View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_118 (Length: 256)
Name: NF10163A_low_118
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_118 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 33326117 - 33325879
Alignment:
| Q |
11 |
ggtcacgatgaattgctgatgcggtctcaattgcagttgcattgtagtttcgacgatatcagagattattatgtttctgtttagattaggggtctggaat |
110 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33326117 |
ggtcacgatgaattgctgatgcggtcttaattgcagttgcattgtagtttcgacgatatcagagattattatgtttctgtttagattaggggtctggaat |
33326018 |
T |
 |
| Q |
111 |
tttannnnnnnacgcttaggttatagataaagtaaatttttaaaaaacaacttggagttgtgatcattagtgtataatatatctgctttgattttgggta |
210 |
Q |
| |
|
| | || ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33326017 |
tct-tttttttacacttaggttatagataaagtcaatttttaaaaaacaacttggagttgtgatcattagtgtataatatatctgctttgattttgggta |
33325919 |
T |
 |
| Q |
211 |
caaattgtgtacccttaagagcaaagtgtaattttgggta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33325918 |
caaattgtgtacccttaagagcaaagtgtaattttgggta |
33325879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University