View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_126 (Length: 250)
Name: NF10163A_low_126
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_126 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 248
Target Start/End: Original strand, 14857968 - 14858203
Alignment:
| Q |
13 |
attctcagctcttctactgatattgagaggcacacggtggattacttaaccaagatttttgctactcctaatcaggttatggcgaattctcttccggata |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14857968 |
attctcagctcttctactgatattgagaggcacacggtggattacttaaccaagatttttgctgctccaaatcaggttatggcgaattctcttccggata |
14858067 |
T |
|
| Q |
113 |
agcttattcctcgactggtcactgatattgaaaatactcagcttacatctcttccttctatggagtaaattaaacaagctgtgttttctcttactggaga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||| |||||| |||||| |
|
|
| T |
14858068 |
agcttattcctcgactggtcactgatattgaaaatactcagcttacatctcttccttctatgaaggaaattaaacaagccgtgtttgctcttaatggaga |
14858167 |
T |
|
| Q |
213 |
ttctgctccaggtccggatggattttcaggatgctt |
248 |
Q |
| |
|
||||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
14858168 |
ttctgctccaggtcctgatggcttttccggatgctt |
14858203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University