View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_128 (Length: 250)
Name: NF10163A_low_128
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_128 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 27 - 238
Target Start/End: Original strand, 4366050 - 4366261
Alignment:
| Q |
27 |
caccctatagatgttttagggaagggattctatgttaccttaggctctcttaagaagagattgatgaaatttccaaattgactttgatctctacaattcc |
126 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4366050 |
caccctatagatgttttaaggaagggattctatgttaccttaggctctcttaagaagagattgatgaaatttccaaattgactttgatctctacaattcc |
4366149 |
T |
 |
| Q |
127 |
aagcttccattctcgtgacttctcttcatctctaattacttcttctccttctaagttgctgcccacatagggagaattaaggggtttgaattttgattct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4366150 |
aagcttccattctcgtgacttctcttcatctctaattacttcttctccttctaagttgctgcccacatagggagaattaaggggtttgaattttgattct |
4366249 |
T |
 |
| Q |
227 |
tctcaattgatg |
238 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
4366250 |
tctctattgatg |
4366261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University