View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_133 (Length: 249)
Name: NF10163A_low_133
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_133 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 42445466 - 42445698
Alignment:
| Q |
1 |
ttctctccaacactgttgcccttagcatatgcaggaataaatggcaaagtagaatcttcattttgtgctaatggatccttgagtgacattgacttcagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445466 |
ttctctccaacactgttgcccttagcatatgcaggaataaatggcaaagtagaatcttcattttgtgctaatggatccttgagtgacattgacttcagag |
42445565 |
T |
|
| Q |
101 |
gaaaggttgttttgtgtgagaggggagggggtataggaagaattgccaaaggacaggaagtacaaagagcaggtggtgccgccatgattctcatgaatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445566 |
gaaaggttgttttgtgtgagaggggagggggtataggaagaattgccaaaggacaggaagtacaaagagcaggtggtgccgccatgattctcatgaatga |
42445665 |
T |
|
| Q |
201 |
tgaactcaatggtttcagtctctcagctgatgt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42445666 |
tgaactcaatggtttcagtctctcagctgatgt |
42445698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University