View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_135 (Length: 249)
Name: NF10163A_low_135
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_135 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 37 - 241
Target Start/End: Complemental strand, 394238 - 394031
Alignment:
| Q |
37 |
tgcaggaggacttgattaattttgtcctttttctttgtgactgcctgttgtcccctcaaactcaattatgtttgcaattaaccatctgggcctcaacatt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
394238 |
tgcaggaggacttgattaattttgtcctttttctttgtgactgcctgttgtcccctcaaactcaattatgttagcaattaaccatctgggcctcaacatt |
394139 |
T |
|
| Q |
137 |
atttgtaggaggttgaacttctttgatttaattctgttccaatttgtgtggttactaattgatgcaag---gtatcctctttatctcacttttacttgga |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
394138 |
atttgtaggaggttgaacttctttgatttaattctgttccaatttgtgtggttactaattgatgcaagcttgtatcctctttatctcacttttacttgga |
394039 |
T |
|
| Q |
234 |
tattgttc |
241 |
Q |
| |
|
|||||||| |
|
|
| T |
394038 |
tattgttc |
394031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University