View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_141 (Length: 245)
Name: NF10163A_low_141
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_141 |
 | |
|
| [»] scaffold0432 (3 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 5 - 212
Target Start/End: Complemental strand, 9804882 - 9804675
Alignment:
| Q |
5 |
tttcatgaaaactccatcaaaagagataaccattcatgagaggttggcaacggcgactggtcgatgtcgatctcagtgaagtttcatggttcttttttct |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9804882 |
tttcatgaaaactccatcaaaagagataaccattcatgagaggttggcaacggcgactgatcgatgtcgatctcagtgaagtttcatggttcttttttct |
9804783 |
T |
|
| Q |
105 |
gatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgagaaatgagga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9804782 |
gatcgatgtcgatctcagtgatggtgcttggagagaggttggcaacagcgattgagggagaaaattgtgtttagggtttcaagagaatgagaaatgagga |
9804683 |
T |
|
| Q |
205 |
tgggagga |
212 |
Q |
| |
|
|||||||| |
|
|
| T |
9804682 |
tgggagga |
9804675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 97 - 240
Target Start/End: Complemental strand, 9817693 - 9817550
Alignment:
| Q |
97 |
ttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgaga |
196 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||||||||||| |||||||| |||||| ||||||| ||||||||||||||||| ||||||| |
|
|
| T |
9817693 |
ttttttctgatcgatgtcgatctcagcaatgttggtaggagagaggttgtcaacggcggatgagggggaaaattgtgtttagggtttcaagataatgaga |
9817594 |
T |
|
| Q |
197 |
aatgaggatgggaggattattttgtttgattgatgtccatctca |
240 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
9817593 |
aatgaggatgggaggattcttttgtttgattgatgtcgatctca |
9817550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 94 - 233
Target Start/End: Complemental strand, 9817577 - 9817438
Alignment:
| Q |
94 |
ttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatg |
193 |
Q |
| |
|
||||||| | |||| ||||||||||||| |||||| ||||||||||||||||| | ||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
9817577 |
ttcttttgtttgattgatgtcgatctcacctatggtggtaggagagaggttggcagcagcggctgagggagaaaactttgtttagggtttcaaaagaatg |
9817478 |
T |
|
| Q |
194 |
agaaatgaggatgggaggattattttgtttgattgatgtc |
233 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||||| |||||| |
|
|
| T |
9817477 |
agaaatgaggattggaggattcttttgattgatcgatgtc |
9817438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 104 - 212
Target Start/End: Complemental strand, 9817448 - 9817341
Alignment:
| Q |
104 |
tgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatgagaaatgagg |
203 |
Q |
| |
|
||||||||||||||| ||| ||||||| || |||||||||||||| ||||| |||||||||||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
9817448 |
tgatcgatgtcgatc-cagcgatggtggtatgagagaggttggcagcggcggctgagggagaaaactgtgtttagggtttctagagaatgagaaatgagg |
9817350 |
T |
|
| Q |
204 |
atgggagga |
212 |
Q |
| |
|
||||||||| |
|
|
| T |
9817349 |
atgggagga |
9817341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 9817812 - 9817777
Alignment:
| Q |
1 |
gaagtttcatgaaaactccatcaaaagagataacca |
36 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9817812 |
gaagtttcatgaaaattccatcaaaagagataacca |
9817777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 90 - 240
Target Start/End: Complemental strand, 11708 - 11558
Alignment:
| Q |
90 |
atggttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagag |
189 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| ||||||| || |||||||||||| | ||| ||||| || |||| ||||||| | | |||||||| |
|
|
| T |
11708 |
atggttcttttttccaatcgatgttgatctcagcgatggtggtatgagagaggttggtagcgggagttgagagataaaactttgttttgagattcaagag |
11609 |
T |
|
| Q |
190 |
aatgagaaatgaggatgggaggattattttgtttgattgatgtccatctca |
240 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||||||||| ||||| |||||| |
|
|
| T |
11608 |
aatgggaagtgaggatgggaggattcttttgtttgatcaatgtcgatctca |
11558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 94 - 212
Target Start/End: Complemental strand, 11585 - 11467
Alignment:
| Q |
94 |
ttcttttttctgatcgatgtcgatctcagtgatggtgctaggagagaggttggcaacggcgattgagggagaaaattttgtttagggtttcaagagaatg |
193 |
Q |
| |
|
||||||| | ||||| ||||||||||||| | | ||| ||| ||||||||||||| || || ||||||||||| | ||| | || ||||| |||||| |
|
|
| T |
11585 |
ttcttttgtttgatcaatgtcgatctcagcggtagtggtagaagagaggttggcagcgacggccgagggagaaaactgtgtgtgggatttcatgagaata |
11486 |
T |
|
| Q |
194 |
agaaatgaggatgggagga |
212 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
11485 |
agaaatgaggatgggagga |
11467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 11820 - 11788
Alignment:
| Q |
1 |
gaagtttcatgaaaactccatcaaaagagataa |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11820 |
gaagtttcatgaaaactccatcaaaagagataa |
11788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University