View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_146 (Length: 244)
Name: NF10163A_low_146
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_146 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 90 - 237
Target Start/End: Original strand, 39231897 - 39232045
Alignment:
| Q |
90 |
cattcgacggcaatgaaaattgtagtttgttgaatgaatgaatacaacctttcaaatttcaattgactatgttttgttttccaagttaagaaattaattt |
189 |
Q |
| |
|
||||||| |||||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39231897 |
cattcgaaggcaatgaaaattgtaatttgttcaatgaatgaattcaacctttcaaatttcaattgactgtgttttgttttccaagttaagaaattaattt |
39231996 |
T |
|
| Q |
190 |
cacaatataaaaagttaaaaatta-atttttctcagtaaatattcttcg |
237 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
39231997 |
cacaatataaaaagttaaaaattatttttttctcagtaaatattattcg |
39232045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University