View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_150 (Length: 244)
Name: NF10163A_low_150
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_150 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 21 - 231
Target Start/End: Complemental strand, 55341954 - 55341744
Alignment:
| Q |
21 |
aattggttggaacgagattgcaatttcaatgtattcattaggaatggtacattatttgattctatttgtgacgctgtatcagcgtctaacaagtagtaat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55341954 |
aattggttggaacgagattgcaatttcaatgtattcattaggaatggtacattatttgattctatttgtgacgctgtatcagcgtctaacaagtagtaat |
55341855 |
T |
 |
| Q |
121 |
cagtttcctgtagtgctaaggccagcttannnnnnnnnnnnngctgcgccaagcatggcaagtcttgcttggaaatccatctcaggtgcttttctcatct |
220 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55341854 |
cagtttcctgtagtgctaaggccagcttattttttgttttttgctgcaccaagcatggcaagtcttgcttggaaatccatctcaggtgcttttctcatct |
55341755 |
T |
 |
| Q |
221 |
cttcgacgatg |
231 |
Q |
| |
|
| |||| |||| |
|
|
| T |
55341754 |
catcgaagatg |
55341744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University