View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10163A_low_152 (Length: 243)

Name: NF10163A_low_152
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10163A_low_152
NF10163A_low_152
[»] chr6 (2 HSPs)
chr6 (22-163)||(12045067-12045208)
chr6 (192-222)||(12045207-12045237)


Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 22 - 163
Target Start/End: Original strand, 12045067 - 12045208
Alignment:
22 tacaacttgggaggaggttgataaaggtgtaaatcacttccaccgtgacggaataacgctattgtgctttttggttgagatctaggttggtgtcactcac 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12045067 tacaacttgggaggaggttgataaaggtgtaaatcacttccaccgtgacggaataacgctattgtgctttttggttgagatctaggttggtgtcactcac 12045166  T
122 aacatttgttctattaatttttattttggtgatatttgtcca 163  Q
    ||||||||||||||||||||||||||||| ||||||||||||    
12045167 aacatttgttctattaatttttattttggcgatatttgtcca 12045208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 222
Target Start/End: Original strand, 12045207 - 12045237
Alignment:
192 cactgttcctccctctcatctcatgtgcttc 222  Q
    |||||||||||||||||||||||||||||||    
12045207 cactgttcctccctctcatctcatgtgcttc 12045237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University