View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_158 (Length: 240)
Name: NF10163A_low_158
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_158 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 94 - 232
Target Start/End: Complemental strand, 4930314 - 4930176
Alignment:
| Q |
94 |
atacaaaactcaaacaaactaggtgcataccaccacccaaacccaaagcttgaagaacaacgacggtgtctccacctacgatagcaacctcaatcttccg |
193 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
4930314 |
atacaaaactcaaacaaaacaggtgcataccaccacccaaacccgaagcttgaagaacaacgacagtgtctccacctacgatcacaacctcaatcttccg |
4930215 |
T |
|
| Q |
194 |
acatggagggggcaaaacctgaaacctacaacaacacca |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4930214 |
acatggagggggcaaaacctgaaacctacaacaacacca |
4930176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University