View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_164 (Length: 239)
Name: NF10163A_low_164
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_164 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 9 - 184
Target Start/End: Complemental strand, 2787435 - 2787260
Alignment:
| Q |
9 |
tggtgtttgtggcgatcgctttttcggattatagggggagtaattgtttgtttcctggacatgaaagggaaatggatcaagttatggagagttttccatt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787435 |
tggtgtttgtggcgatcgctttttcggattatagggtgagtaattgtttgtttcctggacatgaaagggaaatggatcaagttatggagagttttccatt |
2787336 |
T |
|
| Q |
109 |
gatggttggaattgtttgtagcggtttgtttcttatttttccaacttcaagtcgtggaattggatgcatgtctgcc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2787335 |
gatggttggaattgtttgtagcggtttgtttcttatttttccaacttcaaggcgtggaattggatgcatgtctgcc |
2787260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 9 - 181
Target Start/End: Original strand, 19578159 - 19578331
Alignment:
| Q |
9 |
tggtgtttgtggcgatcgctttttcggattatagggggagtaattgtttgtttcctggacatgaaagggaaatggatcaagttatggagagttttccatt |
108 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| | ||||||||| |||||||||||||||| || |||||||||||||||||||||||||| || |
|
|
| T |
19578159 |
tggtgtttgtggctatcgctttttcggattatagggttactaattgtttatttcctggacatgaaaaagagatggatcaagttatggagagttttccttt |
19578258 |
T |
|
| Q |
109 |
gatggttggaattgtttgtagcggtttgtttcttatttttccaacttcaagtcgtggaattggatgcatgtct |
181 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||| |||||||| | ||||||||||||||||||| |
|
|
| T |
19578259 |
gatggttggaataatttgtagcggtttgttccttatttttcctacttcaaggcatggaattggatgcatgtct |
19578331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University