View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_170 (Length: 236)
Name: NF10163A_low_170
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10163A_low_170 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 236
Target Start/End: Original strand, 5739480 - 5739708
Alignment:
Q |
8 |
ttggagtttatgtggcttcttggcgtttttgtttccatctttgtgtnnnnnnnctagctttacttaactattcataattatttcttttttctaacaatgg |
107 |
Q |
|
|
||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5739480 |
ttggactttatgtggcttcttggtgtttttgtttccatctttgtgtaaaaaaactagctttacttaactattcataattatttcttttttctaacaatgg |
5739579 |
T |
 |
Q |
108 |
cagctgccagagaaactaccacactttccaaaatcaagaggcttcatcaacaaaaacaacaaatacagaggcttcctccttgatgaaaatggaggcagat |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5739580 |
cagctgccagagaaactaccacactttccaaaatcaagaggcttcatcaacaaaaacaacaaatacagaggcttcctccttgatgaaaatggaggcagat |
5739679 |
T |
 |
Q |
208 |
ttgtaaattgaatagccattctcggctga |
236 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
5739680 |
ttgtaaattgaatagccattctcggctga |
5739708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University