View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_187 (Length: 230)
Name: NF10163A_low_187
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_187 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 38322868 - 38323091
Alignment:
| Q |
1 |
aatcttgtgataatctttccaaatcaagcatcgatgattcttctacaattgtgtcaattgttcagcaatatcctcaatatatcatgagatatcctatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322868 |
aatcttgtgataatctttccaaatcaagcatcgatgattcttctacaattgtgtcaattgttcagcaatatcctcaatatatcatgagatatcctatcca |
38322967 |
T |
 |
| Q |
101 |
aagtaaagtagagaaagtagtagaggtagattttcctaagctactttctactttaaattctagttttcgaaacaaggaggaaaaattggcattaatatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322968 |
aagtaaagtagagaaagtagtagaggtagattttcctaagctactttctactttaaattctagttttcgaaacaaggaggaaaaattggcattaatatct |
38323067 |
T |
 |
| Q |
201 |
tcatcagaaatggtagactatgtt |
224 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
38323068 |
tcatcagaaatgatagactatgtt |
38323091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University