View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_191 (Length: 229)
Name: NF10163A_low_191
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_191 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 31133889 - 31134027
Alignment:
| Q |
1 |
gaaaacaaaacttggcttattccacaccactgtgagtttagaaaacaaaaacatttgctgaatgcctctcctctcagttccatccaccaccaaaacccta |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31133889 |
gaaaacaaaagttggcttattccacaccactgtgagtttagaaaacaaaaacatttgctgaatgcctctcctctcagttccatccaccaccaaaacccta |
31133988 |
T |
|
| Q |
101 |
aattctccatcccctttctatcaccaccatgccactttc |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31133989 |
aattctccatcccctttctatcaccaccatgccactttc |
31134027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University