View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_205 (Length: 222)
Name: NF10163A_low_205
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_205 |
 | |
|
| [»] scaffold0057 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 23 - 200
Target Start/End: Original strand, 46844530 - 46844707
Alignment:
| Q |
23 |
ccgtgtctgtcttattacatcaaaggaaagtatgatttgctaatttgtgtccgattagaattagaacgattccttgaaggaatgatagtgaataccatga |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46844530 |
ccgtgtctgtcttattacatcaaaggaaagtataatttgctaatttgtgtccgattagaattagaccgattccttgaaggaatgatagtgaataccatga |
46844629 |
T |
|
| Q |
123 |
gatcttgaacctagttgcattattgcattgcaggggtgagatggcattttgcagccatgaatgccgtgaccagaggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46844630 |
gatcttgaacctagttgcattattgcattgcaggggtgagatggcattttgcagccatgaatgccgtgaccagaggat |
46844707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 199
Target Start/End: Complemental strand, 48986 - 48942
Alignment:
| Q |
155 |
ggggtgagatggcattttgcagccatgaatgccgtgaccagagga |
199 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
48986 |
ggggtgagatggcattttgcaaccctgaatgccgtaaccagagga |
48942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University