View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_207 (Length: 222)
Name: NF10163A_low_207
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10163A_low_207 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 23 - 196
Target Start/End: Original strand, 21378359 - 21378532
Alignment:
Q |
23 |
actatattcactccaagctatcttcagttaacctacctgctatttatggtaaccttattggaacagggaactattttgttgttgtagggcttggtactcc |
122 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21378359 |
actatattcactccaagctatcttcagataacctacctgctatttatggtaaccttattggaacagggaactattttgttgttgtagggcttggtactcc |
21378458 |
T |
 |
Q |
123 |
taaaaggaacttgtctcttgtttttgatactggtagtgatctcacttggactcagtgtcaaccttgtgatcgtc |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
21378459 |
taaaaggaacttgtctcttgtttttgatactggtagtgatctcacttggactcagtgtcaaccttgtgctcgtc |
21378532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 46 - 190
Target Start/End: Original strand, 21404851 - 21404995
Alignment:
Q |
46 |
tcagttaacctacctgctatttatggtaaccttattggaacagggaactattttgttgttgtagggcttggtactcctaaaaggaacttgtctcttgttt |
145 |
Q |
|
|
|||| ||||||||| |||| | ||||| |||||||||| ||||||| |||||||||||| |||||||||| |||||||||| | | ||||| ||| ||| |
|
|
T |
21404851 |
tcagctaacctaccagctaaatctggtagccttattggatcagggaattattttgttgttttagggcttggaactcctaaaaaggatttgtcacttattt |
21404950 |
T |
 |
Q |
146 |
ttgatactggtagtgatctcacttggactcagtgtcaaccttgtg |
190 |
Q |
|
|
|||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
21404951 |
ttgacactggtagtgatctcacttggactcaatgtcaaccttgtg |
21404995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University