View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_209 (Length: 221)
Name: NF10163A_low_209
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_209 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 83 - 198
Target Start/End: Original strand, 3445973 - 3446088
Alignment:
| Q |
83 |
tgatcacttgtgattatgacattaaaactgtgtctagccagcaaagaatatctatagtttcccatgatgtcaaatcaatttgatgcttcaaaacataatt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3445973 |
tgatcacttgtgattatgacattaaaactgtgtctagccagcgaagaatatctatagtttcccatgatgtcaaatcaatttgatgcttcaaaacatattt |
3446072 |
T |
 |
| Q |
183 |
tgttcacccacctacc |
198 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3446073 |
tgttcacccacctacc |
3446088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University