View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_211 (Length: 221)
Name: NF10163A_low_211
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_211 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 21 - 211
Target Start/End: Original strand, 38359303 - 38359492
Alignment:
| Q |
21 |
atatcatgcaatcagatttacaatgggatcaattcattagaagcaggatcctaaggaacnnnnnnnccagtcgattatcatgtttcttcatctgttttga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
38359303 |
atatcatgcaatcagatttacaatgggatcagttcattagaagcaggatcctaaggaacaaaaaa-ccagtcaattatcatgtttcgtcatctgttttga |
38359401 |
T |
|
| Q |
121 |
ttggtgctaggcataaatactctactgtgatagaaattgtgtcttgaaatattcgcaatggggcaaatattaacttctggattgattcctg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||||||||||| | ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38359402 |
gtggtgctaggcataaatactctactgtgctagaaaatgtgtcttgaaatattggaaatggggaaaatattaacttctggattgattcctg |
38359492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University