View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_226 (Length: 211)
Name: NF10163A_low_226
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_226 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 9970567 - 9970365
Alignment:
| Q |
1 |
aaagattgaacttacatgtcattatacactcttgtaggatccttcatttagatattcaaagataaagcagatatgtcaatgtgaatgaatttagaaaaga |
100 |
Q |
| |
|
||||||||| |||| ||| ||| | ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9970567 |
aaagattgatcttatatgacatgagacactctggtaggatccttcatttagatattcaaagataaagcagatatgtcaatgtgaat----ttagaaaaga |
9970472 |
T |
 |
| Q |
101 |
atggaaagcattgcctatcaccatcagagaaaggaataagtgcacgagtaattctaatatgacacgaaacttgtaaatgatattttattgttcata-aac |
199 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
9970471 |
atggaaagcattgcctatcactatcagagaaaggaataagtgtacgagtaattctaatatgacacgaaacttgtaaaggatattttattgttcatataac |
9970372 |
T |
 |
| Q |
200 |
acgaaac |
206 |
Q |
| |
|
||||||| |
|
|
| T |
9970371 |
acgaaac |
9970365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University