View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_228 (Length: 210)
Name: NF10163A_low_228
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_228 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 4368006 - 4367824
Alignment:
| Q |
18 |
atcatgctaactaataacaataaaaaaccaatggcatattcaccaccctcaaactagaaccaccacaggtaactctaaaccactagactgactttgggga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4368006 |
atcatgctaactaataacaataaaaaaccaatggcatattcaccaccctcaaactaggaccaccacaggtaactctaaaccactagactgactttgggga |
4367907 |
T |
|
| Q |
118 |
tctaattcacaggcagaattcctgctgacacattccaaaataaaaa---------attttgctattggtctagtcgtcaacac |
191 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4367906 |
tctaattcacagacagaattcctgctgacacattccaaaataaaaaataaaaaatattttgctattggtctagtcgtcaacac |
4367824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University