View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_233 (Length: 208)
Name: NF10163A_low_233
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_233 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 70 - 149
Target Start/End: Complemental strand, 25196202 - 25196123
Alignment:
| Q |
70 |
actgaaccagccgtaaaaataaaacctcgtcgggaaagccgccggagttggcctccgtctaccatcagcaacggtgagat |
149 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25196202 |
actgaactggccgtaaaaataaaacctcgtcgggaaagccgccggagttggcctccgtctaccatcagcaacggtgagat |
25196123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University