View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_236 (Length: 205)
Name: NF10163A_low_236
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_236 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 26 - 178
Target Start/End: Original strand, 54891894 - 54892046
Alignment:
| Q |
26 |
aatatggtaggagtttattccttaaaaaacaatatgcatgtttatgtttatgtttcctcagattatgtgtacaactgtacattgatgctttgagcttgca |
125 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54891894 |
aatatggtaggagtttattccttaaaaaaaaatatgcatgtttatgtttatgtttcctcagattatgtgtacaactgtacattgatgctttgagtttgca |
54891993 |
T |
 |
| Q |
126 |
tttgagtggtgcannnnnnnctttctgtttgggtagaattgatggataattgt |
178 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54891994 |
tttgagtggtgcatttttttctttctgtttgggtagaattgatggataattgt |
54892046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 70 - 123
Target Start/End: Original strand, 54879249 - 54879303
Alignment:
| Q |
70 |
tgtttatgtttcctcagattatgtgtacaactgtaca-ttgatgctttgagcttg |
123 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
54879249 |
tgtttatgttccttcagattatgtgtacaactgtgcatttgatgctttgagcttg |
54879303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 66 - 99
Target Start/End: Original strand, 54879064 - 54879097
Alignment:
| Q |
66 |
tttatgtttatgtttcctcagattatgtgtacaa |
99 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
54879064 |
tttatgtttatgttccctcagattatgtgtacaa |
54879097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University