View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_242 (Length: 201)
Name: NF10163A_low_242
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_242 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 177
Target Start/End: Complemental strand, 45343140 - 45342980
Alignment:
| Q |
17 |
ttggagttgggagtaataggcccacaaacatcagcatgtacaagctgcaatttttgggaagctctccattgactcttctttggaatggcatctctatgtt |
116 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45343140 |
ttggagttgggagtaataggcccgcaaatatcagcatgtacaagctgcaatttatgggaagctctccattgactcttctttggaatggcatctctatgtt |
45343041 |
T |
 |
| Q |
117 |
gcttgccgacaaaacattcagtacaacttttatttgaagctttaacaagtggaaggccctt |
177 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45343040 |
gcttgctgacaaaacattcagtacaacttttatttgaagctttaacaagtggaaggccctt |
45342980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University