View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_38 (Length: 367)
Name: NF10163A_low_38
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 179 - 245
Target Start/End: Original strand, 28039871 - 28039938
Alignment:
| Q |
179 |
aattggatagttaaaagc---atggtttgattttatcctttttgtttagagatattataattttatgttc |
245 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28039871 |
aattggatagttagaagccgcatggtttaattttatc--ttttgtttagagatattataattttatgttc |
28039938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 28039665 - 28039715
Alignment:
| Q |
1 |
agagagaaagaaattgtgtttggtccttatttttggtcattgttgaaatat |
51 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
28039665 |
agagagaaagaaaatgtgtttggtcattgttttttatcattgttgaaatat |
28039715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University