View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_55 (Length: 327)
Name: NF10163A_low_55
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 178 - 307
Target Start/End: Complemental strand, 18796206 - 18796077
Alignment:
| Q |
178 |
ttacaattgatgatggcacacttttagagtgatttgaatgttatggtatgagatgattgccaagataacaatgatcacaacacactactaaattttatta |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18796206 |
ttacaattgatgatggcacacttttagagtgatttgaatgttatggtatgagatgattgccaagataacaatgatcacaacacactactaaattttatta |
18796107 |
T |
|
| Q |
278 |
cttgcatcacacatttatacaagatgttct |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18796106 |
cttgcatcacacatttatacaagatgttct |
18796077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University