View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10163A_low_55 (Length: 327)

Name: NF10163A_low_55
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10163A_low_55
NF10163A_low_55
[»] chr7 (1 HSPs)
chr7 (178-307)||(18796077-18796206)


Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 178 - 307
Target Start/End: Complemental strand, 18796206 - 18796077
Alignment:
178 ttacaattgatgatggcacacttttagagtgatttgaatgttatggtatgagatgattgccaagataacaatgatcacaacacactactaaattttatta 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18796206 ttacaattgatgatggcacacttttagagtgatttgaatgttatggtatgagatgattgccaagataacaatgatcacaacacactactaaattttatta 18796107  T
278 cttgcatcacacatttatacaagatgttct 307  Q
    ||||||||||||||||||||||||||||||    
18796106 cttgcatcacacatttatacaagatgttct 18796077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University