View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_59 (Length: 321)
Name: NF10163A_low_59
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 319
Target Start/End: Original strand, 36170382 - 36170700
Alignment:
| Q |
1 |
gttgaggaagttaagagatttatggttgaggaggatgcggtgtcgacttttatcaggctagtgaaatcaaaggaggaagcaattcaggtgaattcaatag |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170382 |
gttgaggaagttaagagattcatggttgaggaggatgcggtgtcgacttttatcaggctagtgaaatcaaaggaggaagcaattcaggtgaattcaatag |
36170481 |
T |
 |
| Q |
101 |
ggttcattcagaatattgcctttggagatgagttggttaggcaaacggtgattagagaaggcggaatccgtgctttgttacgtgttttagatccgaaatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170482 |
ggttcattcagaatattgcctttggagatgagttggttaggcaaatggtgattagagaaggcggaatccgtgctttgttacgtgttttagatccgaaatg |
36170581 |
T |
 |
| Q |
201 |
gtcatattcttcaaaaacaaaggaaataacaatgagggctattgaaagtttgtgttttacttcatctagctctgtaagtattttaatgagttatggtttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170582 |
gtcatattcttcaaaaacaaaggaaataacaatgagggctattgaaagtttgtgttttacttcatctagctctgtaagtattttaatgagttatggtttt |
36170681 |
T |
 |
| Q |
301 |
gtggatcagttgctatatt |
319 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36170682 |
gtggatcagttgctatatt |
36170700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 267 - 319
Target Start/End: Complemental strand, 1286394 - 1286342
Alignment:
| Q |
267 |
tagctctgtaagtattttaatgagttatggttttgtggatcagttgctatatt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1286394 |
tagctctgtaagtattttaatgagttatggttttgtggatcagttgctatatt |
1286342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University