View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_62 (Length: 311)
Name: NF10163A_low_62
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_62 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 21 - 171
Target Start/End: Original strand, 31114516 - 31114667
Alignment:
| Q |
21 |
cttttctcccaatcaaataagcttt-agaaccaatgtccattcaaagaggtggatcccattatgccactcactctccattatctgcattgatgatagaag |
119 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114516 |
cttttctcccaatcaaataagcttttagaaccaatgtcctttctaagagttgggtcccattatgccactcactctccattatctgcattgatgatagaag |
31114615 |
T |
 |
| Q |
120 |
cttgtatcccataaacacagtgaactgggttcactttggacgattcatggac |
171 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31114616 |
cttgtatcccagaaacacagtgaactgggttcactttggtcgattcatggac |
31114667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 239 - 297
Target Start/End: Original strand, 31114681 - 31114739
Alignment:
| Q |
239 |
ataaatgggttgaagcatcaaaacgacgtcatctttatctatccttggttgatgtccat |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114681 |
ataaatgggttgaagcatcaaaacgacgtcatctttatctatccttggttgatgtccat |
31114739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 86 - 198
Target Start/End: Original strand, 31088499 - 31088611
Alignment:
| Q |
86 |
actcactctccattatctgcattgatgatagaagcttgtatcccataaacacagtgaactgggttcactttggacgattcatggacgcaattatgttcaa |
185 |
Q |
| |
|
|||||||||| || || || ||||||||| |||||| |||| | |||||||| ||| |||||||||||| | ||||| |||| ||||||||||||| |
|
|
| T |
31088499 |
actcactctctgttgtccgctttgatgatataagcttctatcaaagaaacacagagaagtgggttcactttcgttgattcgtggatacaattatgttcaa |
31088598 |
T |
 |
| Q |
186 |
cccccactctcaa |
198 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
31088599 |
cccacactctcaa |
31088611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University