View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_71 (Length: 306)
Name: NF10163A_low_71
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_71 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 140 - 284
Target Start/End: Complemental strand, 14878939 - 14878795
Alignment:
| Q |
140 |
gaagaatattggtgaaatgaagagaatgttttgagcttgaatagcttaattcttttcttgcaagtaattctcttaatgtttaaagttgagtacgtgtgta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14878939 |
gaagaatattggtgaaatgaagagaatgttttgagcttgaatagcttaattcttttcttgcaaataattctcttaatgtttaaagttgagtacgtgtgta |
14878840 |
T |
 |
| Q |
240 |
tttgtatgagcctttaggctttaaaattgtagagcactaagctat |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14878839 |
tttgtatgagcctttaggctttaaaattgtagagcagtaagctat |
14878795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University