View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_74 (Length: 302)
Name: NF10163A_low_74
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10163A_low_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 22 - 289
Target Start/End: Original strand, 43098816 - 43099081
Alignment:
Q |
22 |
aaactagctgtaacaatgtcaggcaaaagagacaagtttggtcagcatttaataaagttcgaaaactagaacatgtaacagactaacagcagcttgcaaa |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
43098816 |
aaactagctgtaacaatgtcaggcaaaagagacaagtttggtcagcatttaataaagttcgaaaactagaacatgtaacagactaacagctgcttgcaaa |
43098915 |
T |
 |
Q |
122 |
atgcaaaatcatatagtactactgtctaaaacttgtatgtcaggtctagctcaccatttgatgacacttacattagtatatagttgaacatgcatttcta |
221 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
43098916 |
atgcaaaatcatatagtactaccgtctaaaacttgtatgtcaggtctagctcaccatttgatgacacttacattag--tatagttgaacatgcatttcta |
43099013 |
T |
 |
Q |
222 |
taaaagtatactgtacaaatgcagttttttaacaagaaatatatttgggtaaatgatcactttgatct |
289 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
43099014 |
taaaagtatactgtacaaatgcagttttttaacaagaaatatatttgggtaaatgatcactttaatct |
43099081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University