View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10163A_low_85 (Length: 290)
Name: NF10163A_low_85
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10163A_low_85 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 7815585 - 7815804
Alignment:
| Q |
19 |
cgtgtttccttagcaatttctgtctcagcaaaatccaaaaataaaacatcataatatccttttaaaaatacaacaaactacacggatggaacataattca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7815585 |
cgtgtttccttagcaatttctgtctcagcaaaatccaaaaataaaacatcataatatccttttaaaaatacaacaaactacacggatggaacat------ |
7815678 |
T |
 |
| Q |
119 |
catgccacatatgacatgatttacatggttttgtccattgaagttttcttaatgtgattttagagatttgctttggatatgttttttgttggaaaacatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7815679 |
----------atgacatgatttacatggttttgtccattgaagttttcttaatgtgattttagagatttgctttggatatgttttttgttggaaaacatt |
7815768 |
T |
 |
| Q |
219 |
gaacaaggcaaataaatgccatgatccacaggttct |
254 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7815769 |
gaacaaggcaaataaatgccatgatcctcaggttct |
7815804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University